circad | circRNAs associated with diseases

circ_CCT4
Gene	CCT4	Organism	Human
Genome Locus	chr2:62099217-62110683:n/a	Build	hg19
Disease	Temporal Lobe Epilepsy	ICD-10	Malignant neoplasm of Long bones of lower limb (C40.2)
DBLink	Link to database	PMID	29428937
Experimental Method
Sample Type	Brain Tissues	Comparison	Temporal cortices were collected from 17 Temporal Lobe Epilepsy (TLE) patients and 17 non-TLE patients
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GTCATTCCATCTACACTAGC Reverse CACCTTTTCCATCTTGAATCTTTC	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Li, J, Lin, H, Sun, Z, Kong, G, Yan, X, Wang, Y, Wang, X, Wen, Y, Liu, X, Zheng, H, Jia, M, Shi, Z, Xu, R, Yang, S, Yuan, F (2018). High-Throughput Data of Circular RNA Profiles in Human Temporal Cortex Tissue Reveals Novel Insights into Temporal Lobe Epilepsy. Cell. Physiol. Biochem., 45, 2:677-691.